Preparing Your Samples

Sequencing Primer Design

The quality of your sequencing primer directly affects the quality of the DNA sequencing results. Therefore, we recommend the following guidelines for preparing sequencing primers.

Guidelines for Sequencing Primer Design

  1. Perfect Matches
  2. Primer length should be at least 18-23bp
  3. Primer melting temperature (Tm) should be 55-60°C.  Try to avoid low Tm (below 50°C).
  4. GC content should be ~50-55%
  5. G or C on the 3` end of the primer
  6. Long stretches of the same base, palindromic sequences, and hairpin structures should be avoided

 

IDT Oligo Analyzer

  • Analyzes primer sequence for TM, GC content, secondary structure, primer dimer interactions, and performs a BLAST to ensure specificity of sequence design.

We offer several standard "in-house" primers for Standard DNA sequencing:

  • All sequencing primers listed below have been independently validated for use in sequencing reactions.
Primer Name Description Primer Sequence
M13-R M13 reverse primer CAGGAAACAGCTATGAC
M13-F M13 forward primer TGTAAAACGACGGCCAGT
T7 T7 promoter forward primer TAATACGACTCACTATAGGG
T3 T3 promoter forward primer GCAATTAACCCTCACTAAAGG
SP6 SP6 promoter forward primer ATTTAGGTGACACTATAG
CMV-F Human CMV promoter forward primer CGCAAATGGGCGGTAGGCGTG
IRES-F 3` end of IRES element forward primer TGGCTCTCCTCAAGCGTATT
IRES-R 5` end of IRES element reverse primer CCTCACATTGCCAAAAGACG
EF1a-F Human EF1a promoter forward primer TCAAGCCTCAGACAGTGGTTC
WPRE-R 5` end of WPRE element reverse primer CATAGCGTAAAAGGAGCAACA
MU6-F Murine U6 promoter forward primer CAGCACAAAAGGAAACTCACC
MPGK-F Murine PGK promoter forward primer CATTCTGCACGCTTCAAAAG
MSCV-F Murine stem cell virus forward primer CCCTTGAACCTCCTCGTTCGACC
MSCV-R Murine stem cell virus reverse primer CAGCGGGGCTGCTAAAGCGCATGC
HUBIC-F Human UBIC promoter forward primer TGAAGCTCCGGTTTTGAACT
KS KS primer (Bluescript) CGAGGTCGAGGTATC
SK SK primer (Bluescript) TCTAGAACTAGTGGATC
BGH-R BGH reverse primer TAGAAGGCACAGTCGAGG
RV Primer 3   CTAGCAAAATAGGCTGTCCC
RV Primer 4   GACGATAGTCATGCCCCGCG
GL Primer 2   CTTTATGTTTTTGGCGTCTTCCA
Luc-N-Rev 5` Luciferase Gene CCTTATGCAGTTGCTCTCC
Luc-For 3` Luciferase Gene AGTCAAGTAACAACCGCGA
LacZ-Rev 5` LacZ Gene GACAGTATCGGCCTCAGGAA
SV40-For SV40 Promoter TATTTATGCAGAGGCCGAGG
SV40-Rev SV40 PolyA Tail GAAATTTGTGATGCTATTGC
cPPt-Rev   ATTCTTTCCCCTGCACTGTACCCC
pGEX 5` 3’ end of glutathione-S-transferase, forward primer GGGCTGGCAAGCCACGTTTGGTG
pGEX 3` 3’ of MCS in pGEX vectors, reverse primer CCGGGAGCTGCATGTGTCAGAGG

For additional sequencing primer information, please refer to Addgene.

 

Preparing DNA

The quality of your template directly affects the quality of the DNA sequencing results.  Therefore, we recommend the following suggestions for sample preparation:

 

Host Strain Recommendations

Host strain selection is important and if possible it is best to use a highly recommended host strain. Please refer to the chart below before choosing a host strain:

Highly Recommended Recommended Not Recommended
DH5 alpha JM109 JM101
HB101 XL-1 Blue MV1190
DH10 XL-10 Gold  

Methods for DNA Template Preparation

We recommend that the DNA template be free of protein, RNA, and any contaminants from the isolation or purification procedure (buffers, salts, organics, ethonol).  We suggest using one of the following kits for DNA isolation/purification:

 

For Plasmid DNA

For PCR Products

Preparations that are NOT Recommended

  • Bio 101 GeneKleen
  • Cesium Chloride

** We recommend eluting or resuspending DNA in sterile Dnase/Rnase-free water, NOT Tris-EDTA (TE).  Certain buffer components have the potential to inhibit downstream applications such as DNA sequencing reactions.**

 

Allowable Contaminant Concentrations in DNA Templates

Values greater than those listed in the chart below may significantly reduce the quality of your sequencing results.

Contaminant Amount Tolerated in Sequencing Reaction
RNA 1ug
PEG 0.3%
NaOAc 0.5mM
Ethanol 1.25%
Phenol/Chloroform 0%
CsCl 5mM
EDTA 0.25mM

DNA Quality

DNA should be quantified using a spectrophotometer.  We have provided a Nanodrop workstation for free general use in 3-6807 at the Medical Center. 

 

As a general guideline, DNA free of major contamination should provide OD260/280 of 1.7 - 1.9 and OD260/230 of ~2.0.  Lower OD260/280 usually indicates protein contamination while high ratios are indicative of organic contamination. 

 

The URGRC also has a Qubit 2.0 Flourometer for nucleic acid quantitation and several Agilent 2100 Bioanalyzer systems for determining both quantity and quality.

 

Comparison of Qubit 2.0 vs. Nanodrop 1000.

 

Questions?

For questions or feedback regarding DNA Sequencing, please contact us.