Skip to main content
Explore URMC

URMC Logo

menu
URMC / Microbiology & Immunology / Xenopus Laevis / Primers Available
 

Primers Available

Conventional PCR primer list for X. laevis house keeping and other genes

Primers name  Primer direction and/or sequence a Size (bp) TM (oC)
Adult beta-globin F: 5’ - GACAGCACATGATCGTCAGC- 3’
F: 5’ - CTTCATGGAAGTGGCGAGCC- 3’
58 351
EF-1α F: 5’ - CCTGAATCACCCAGGCCAGATTGGTG - 3’
R: 5’ - GAGGGTAGTGTGAGAAGCTCTCCACG - 3’
250 56
GAPDH F: 5’ - ACCCCTTCATCGACTTGGAC - 3’
R: 5’ - GGAGCCAGACAGTTTGTAGTG - 3’
300 55
Gp96 F: 5’ - GCGTTGGTTTCTATTCTGCCTTC- 3’
F: 5’ - TGTCTCAGTCTTGCTGCTCCACAC- 3’
56 400
Hsp72 F: 5’ - AGACTGATCGGGAGAAAGTTC - 3’
R: 5’ - CTTTTCCACAGGTTCCAAGGTACCC - 3’
58 747
Hsc73 F: 5’ - TGGAGTAGAAAGGAATGTACTGATC - 3’
R: 5’ - AACTTCATTGCATTTCTCCAG - 3’
58 1174
LMPX F: 5’ - TATCAGTGTCTTCCGCCTCC - 3’
R: 5’ - CAGCCGTCCTCCTTCATGTG - 3’
56-64 300

Conventional PCR primer list for Xenopus laevis immune receptor genes

Primer Sequence (5’-3’ forward/reverse) Tm (°C) Size (bp)
b2-microglobulin consensus F: 5’ - TGACGGTGAATCCTGGAGAC- 3’
R: 5’ - CGATAGCCGTGACAATGAGC- 3’
57 800
CD4 F: 5’ - TCCATCTCTGACATCCCCTC- 3’
R: 5’ - TCACCAGACACACGTCCATT- 3’
60 895
CD8 a F: 5’ - AAGCCACCTACGACTACCACCAA- 3’
R: 5’ - CCGTTCTTCTCAGTCTCAGGCAC- 3’
59 247
CD8 β F: 5’ - TCATCATCTCTTTCTGGGGC- 3’
R: 5’ - AATTCAGTGGGTGCTTCCTG- 3’
60 604
CTX F: 5’ - GCAgcagcggtaatcggag- 3’
R: 5’ - ctcagcatggtcatggaattg- 3’
58 220
Ig Y F: 5’ - ATGGAGGAGCCAACTCACCATC- 3’
R: 5’ - AAGGTGGCAGCAAGGTGATTG- 3’
58 720
Ig M F: 5’ - TCTTCTCTTGTAAGGAACCCG- 3’
R: 5’ - GCAATGCCAAACACCTGG- 3’
58 350
MHC class Ia
f strain
F: 5’ - GAGTTCTTTGCCCTGGATACA- 3’
R: 5’ - CACAATAAGTTTCTCCTTCAGG- 3’
61 400
MHC class Ia
j strain
F: 5’ - GAGTTCATAGCGCTGGATACA- 3’
R: 5’ - CCTCACTGGGTGTAATCTCAG- 3’
61 400
MHC II a chain F: 5’ - TCAAAGTCAGTGGTTTGGACG- 3’
R: 5’ - GTGTAAATATCATGTTCATTTG- 3’
61 390
MHC II b chain F: 5’ - ACGGCACCGACAATGTCAGG- 3’
TTAATGGGTGTCTCCAGCATC- 3’
61 450
TCR a F: 5’ - TTCAGGGACCTCTGGTTGCTTC- 3’
R: 5’ - ACACATCAGCCTCAATCCATCC- 3’
60  
TCR V b 1 F: 5’ - CACCCAGGAGCCAAGATC- 3’ 56 700
TCR V b 3 F: 5’ - TGACGGTGAATCCTGGAGAC- 3’ 58 700
TCR V b 6 F: 5’ - GTCAGCTGACATTCCTTGTAATC- 3’ 58 700
TCR V b 8 F: 5’ - GACCAAAAGTTCTTAGCG- 3’ 50 700
TCR b constant R: 5’ - CGATAGCCGTGACAATGAGC- 3’ 50-58 700
TCR g F: 5’ - AGAAGTTCTCAAGCAGGCAG- 3’
R: 5’ - AAGTCAGCTGAAGAGGATCC- 3’
60 328
XNC 2 F: 5’ - GGTATCAAACCGTATCTATGGTG- 3’
R: 5’ - TCTCTATATACTCCTTACTATCAG- 3’
59 450
XNC 6 F: 5’ - CTTTGCATGATCGTAATG- 3’
R: 5’ - CTGCATATCTAGATGGCTTG- 3’
52 386
XNC 7 F: 5’ - CCGATGTGAGCCTTTGTTTCAG- 3’
R: 5’ - GTGCACTCATTTTCCATGAATAGT- 3’
59 380
XNC 11 F: 5’ - CGATGACTTCTTCACCGACC- 3’
R: 5’ - CCTTGCTCCACTCTGGTATG- 3’
58 350

Conventional PCR primer list for X. laevis cytokine and other genes

Primers name  Primer direction and/or sequence a Size (bp) TM (oC)
AID F: 5’ -  TCACGACCCCCATAGGAACTAC - 3’
R: 5’ -  TTAGGAGACTTTGCCTCAAGG - 3’
450 58
Arginase I F: 5’ - CTTACAATGAGTAGTAGCCAAGG - 3’
R: 5’ - GCAGAGAAAATGAGGATTCG - 3’
378 56
IL-1β F: 5’ - AACAGAAGATGGCCAAGACTC - 3’
R: 5’ - ATGCAACCGATTCAAAGC - 3’
150 60
Type II IFN (gamma) F: 5’ - CTGAGGAAATACTTTAACTCCATTGACC - 3’
R: 5’ - TTGTAACATCTCCCACCTGTATTGTC - 3’
300 60
MX1 F: 5’ - AGGAGTGGTCAACAGGAGCC- 3’
R: 5’ - TGTTCCGCCGCTGTTCCTCT- 3’
829 68
MX2 F: 5’ - GGAACGCCGCACTTGCAGAA- 3’
R: 5’ - CGATTAATCCTGGCACCTCC- 3’
274 68
TNF-α F: 5’ - GCTCAAGGATAACTCCATCG - 3’
R: 5’ - AACCAAGTGGCACCTGAATG - 3’
203 59
Rag1 F: 5’ - GCGCCAAGAATCTGTGTCACT- 3’
R: 5’ - GTTCTGTTTCATGGTTGTCTACCA- 3’
350 58
Mycobacterium marinum F: 5’ - AGAGTTTGATCCTGGCTCAG - 3’
R: 5’ - CACGCTCACAGTTAAGCCGT - 3’
378 56
DM-W (sex determination) F: 5’ - CCACACCCAGCTCATGTAAAG- 3’
R: 5’ - GGGCAGAGTCACATATACTG- 3’
260 52

Conventional PCR primer list for pathogens of X. laevis

Primers name  Primer direction and/or sequence a
Ranavirus FV3
Size (bp) TM (oC)
vDNA polymerase II (60R) F: 5’ - ACGAGCCCGACGAAGACTACATAG - 3’
R: 5’ - TGGTGGTCCTCAGCATCCTTTG - 3’
378 56
MCP F: 5’ - GACTTGGCC ACTTATGAC - 3’
R: 5’ - GTCTCTGGAGAAGAAGAAGAA - 3’
525 52
vCARD (64R)

 

F: 5’ - AGACCCTCCAGAACCTGATTGAC - 3’
R: 5’ - TCTCCCTTCTTGGTGACGCTGT - 3’
150 59
vβHSD (52L) F: 5’ - CACTGTCCACGATCACGTCTACC - 3’
R: 5’ - AACTTTACGCCCGTCACCCTCA - 3’
550 60
vICP-18 (18K) F: 5’ - ATGATCCAAGCCTACCTGTGC- 3’
R: 5’ - AAATGTCCTAATCTATACACC- 3’
450 52
veIF-2α (vIF-2α) F: 5’ - CTGTAAATGTTTAGACTTGGAGTG- 3’
R: 5’ - ACACAAAGGGGCACAGTCCTCC- 3’
   
53R F: 5’ - ATCAGTCACAGGTCTTTAGCATAG- 3’
R: 5’ - TCTGCTTGATCTCGGGACACAATG- 3’
441 56
EGFP F: 5’ - ACGGCCACAAGTTCAGCGTG - 3’
R: 5’ - GTCCATGCCGAGAGTGATCC - 3’
350 56
M. marinum F: 5’ - AGAGTTTGATCCTGGCTCAG - 3’
R: 5’ - CACGCTCACAGTTAAGCCGT  - 3’
378 56
Chytrid F: 5’ - AGCCAAGAGATCCGTTGTCAAA- 3’
R: 5’ - CCTTGATATAATACAGTGTGCCATATC- 3’
250 60
CTX F: 5’ - GCAGCAGCGGTAATCGGAG- 3’
R: 5’ - CTCAGCATGGTCATGGAATTG- 3’
220 58

Conventional Q-PCR primer list for X. laevis genes

Primers  Primer direction and/or sequence
GAPDH F: 5’ - GACATCAAGGCCGCCATTAAGACT - 3’
R: 5’ - AGATGGAGGAGTGAGTGTCACCAT - 3’
EF-1α F: 5’ - GCCTTCCCAGGGTTCAACAT - 3’
R: 5’ - TCGGTGGGTCACTCTTTGAAT  - 3’
GCSF-R F: 5’ - ACGTGCCAGCTA AACCTCACAGAT - 3’
R: 5’ - TGA CACAGCCTGGGCGAGAAATAA  - 3’
IL-1β F: 5’ - CATTCCCATGGAGGGCTACA - 3’
R: 5’ - TGACTGCCACTGAGCAGCAT - 3’
IL-10 F: 5’ - TGCTGGATCTTAAGCACACCCTGA - 3’
R: 5’ - TGTACAGGCCTTGTTCACGCATCT - 3’
Type I IFN F: 5’ - GCTGCTCCTGCTCAGTCTCA- 3’
R: 5’ - GAAAGCCTTCAGGATCTGTGTGT- 3’
Type II IFN (gamma) F: 5’ - CTGAGGAAATACTTTAACTCCATTGACC - 3’
R: 5’ - TTGTAACATCTCCCACCTGTATTGTC- 3’
Type III IFN (lambda) F: 5’ - TCCCTCCCAACAGCTCATG- 3’
R: 5’ - CCGACACACTGAGCGGAAA - 3’
IFN lambda receptor
(IFNLR1)
F: 5’ - GGAGCCTGATCCCAATGAATTA- 3’
R: 5’ - TCTCAAAGCGCACACTAAGG- 3’
MCSF-R
 
F: 5’ - TGTATTCTTTGG ACT TGC CGT ATCTGG - 3’
R: 5’ - TTGTTTAGCTTCAAATTCTGGGTAATA - 3
MX1 F: 5’ - AGCAGTGGTCAACAGGAGCC - 3’
R: 5’ - TGTTCCGCCGCTGTTCCTCT - 3
MX2 F: 5’ - GGAACGCCGCACTTGCAGAA - 3’
R: 5’ - CGATTAATCCTGGCACCTCC - 3
TNF-α F: 5’ - TGTCAGGCAGGAAAGAAGCA - 3’
R: 5’ - CAGCAGAGCAAAGAGGATGGT- 3’
HSP70 F: 5’ - CTCATCAAGCGCAACACAAC - 3’
R: 5’ - CTCCCTCAAACACCTGGATAAG- 3’
Glucocorticoids (GCs) (CYP11A1) F: 5’ - GGAGGAGTAGACACGACATCTA - 3’
R: 5’ - GGCAGTAAGATCCTTTCCAGAG- 3’
Thyroid hormone receptor α (THRα) F: 5’ - GTTCTGGATGGAATTACG - 3’
R: 5’ - CATACATTGGCTGTTCTT- 3’
IL-34 F: 5’ - AGCTCTTCTACGTGTATTCCTTGG - 3’
R: 5’ - TGATAAGCGATTGACCTACCTGGG - 3’
iNOS F: 5’ - AACCGTAAGCCAAAGAAGGA - 3’
R: 5’ - TGGTTCTGGCAGCCACAGT - 3’
Pathogens
FV3 vDNA Polymerase II
(60R)
F: 5’ - AACCCTCGCCTGGCATCTA - 3’
R: 5’ - TGGTGGTCCTCAGCATCCT - 3’
FV3-PKR F: 5’ - GCTCACCGGCGGGATTA - 3’
R: 5’ - TTCAACTTTATTCATGCGTGCTATC - 3’
M. marinum F: 5’ - AGAGTTTGATCCTGGCTCAG- 3’
R: 5’ - CACTCGAGTATCTCCGAAGA - 3’