Skip to main content
Explore URMC
URMC / Microbiology & Immunology / Research / Xenopus Laevis / Primers Available

Primers Available

Conventional PCR primer list for X. laevis house keeping and other genes

Primers name  Primer direction and/or sequence a Size (bp) TM (oC)
Adult beta-globin F: 5’ - GACAGCACATGATCGTCAGC- 3’
58 351
250 56
300 55
56 400
58 747
58 1174
56-64 300

Conventional PCR primer list for Xenopus laevis immune receptor genes

Primer Sequence (5’-3’ forward/reverse) Tm (°C) Size (bp)
b2-microglobulin consensus F: 5’ - TGACGGTGAATCCTGGAGAC- 3’
57 800
60 895
59 247
60 604
CTX F: 5’ - GCAgcagcggtaatcggag- 3’
R: 5’ - ctcagcatggtcatggaattg- 3’
58 220
58 720
58 350
MHC class Ia
f strain
61 400
MHC class Ia
j strain
61 400
61 390
61 450
TCR V b 1 F: 5’ - CACCCAGGAGCCAAGATC- 3’ 56 700
TCR V b 8 F: 5’ - GACCAAAAGTTCTTAGCG- 3’ 50 700
TCR b constant R: 5’ - CGATAGCCGTGACAATGAGC- 3’ 50-58 700
60 328
59 450
52 386
59 380
58 350

Conventional PCR primer list for X. laevis cytokine and other genes

Primers name  Primer direction and/or sequence a Size (bp) TM (oC)
450 58
378 56
150 60
300 60
829 68
274 68
203 59
350 58
Mycobacterium marinum F: 5’ - AGAGTTTGATCCTGGCTCAG - 3’
378 56
DM-W (sex determination) F: 5’ - CCACACCCAGCTCATGTAAAG- 3’
260 52

Conventional PCR primer list for pathogens of X. laevis

Primers name  Primer direction and/or sequence a
Ranavirus FV3
Size (bp) TM (oC)
vDNA polymerase II (60R) F: 5’ - ACGAGCCCGACGAAGACTACATAG - 3’
378 56
525 52
vCARD (64R)


150 59
550 60
450 52
441 56
350 56
M. marinum F: 5’ - AGAGTTTGATCCTGGCTCAG - 3’
378 56
250 60
220 58

Conventional Q-PCR primer list for X. laevis genes

Primers  Primer direction and/or sequence
IFN lambda receptor
Glucocorticoids (GCs) (CYP11A1) F: 5’ - GGAGGAGTAGACACGACATCTA - 3’
Thyroid hormone receptor α (THRα) F: 5’ - GTTCTGGATGGAATTACG - 3’
FV3 vDNA Polymerase II